Variant | Gene | Disease | Risk Allele | Score vda | Association Type | Original DB | Sentence supporting the association | PMID | PMID Year | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
|
|
T | 0.700 | CausalMutation | CLINVAR | Frequent large germline HRPT2 deletions in a French National cohort of patients with primary hyperparathyroidism. | 23293331 | 2013 | ||||||
|
|
|
0.800 | GeneticVariation | UNIPROT | HRPT2 mutations are associated with malignancy in sporadic parathyroid tumours. | 12960210 | 2003 | |||||||
|
|
|
0.800 | GeneticVariation | UNIPROT | The parafibromin tumor suppressor protein is part of a human Paf1 complex. | 15632063 | 2005 | |||||||
|
|
|
C | 0.800 | CausalMutation | CLINVAR | |||||||||
|
|
|
0.800 | GeneticVariation | UNIPROT | Parafibromin mutations in hereditary hyperparathyroidism syndromes and parathyroid tumours. | 16487440 | 2006 | |||||||
|
|
|
0.800 | GeneticVariation | UNIPROT | HRPT2, encoding parafibromin, is mutated in hyperparathyroidism-jaw tumor syndrome. | 12434154 | 2002 | |||||||
|
|
|
0.800 | GeneticVariation | UNIPROT | Clinical, genetic, and histopathologic investigation of CDC73-related familial hyperparathyroidism. | 18755853 | 2008 | |||||||
|
|
|
0.710 | GeneticVariation | BEFREE | A germline p.M1I mutation has been previously reported in a family with clinical features of HPT-JT. | 30452964 | 2019 | |||||||
|
|
|
A | 0.710 | CausalMutation | CLINVAR | |||||||||
|
|
|
G | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
CT | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
G | 0.700 | GeneticVariation | CLINVAR | |||||||||
|
|
|
0.700 | GeneticVariation | UNIPROT | HRPT2, encoding parafibromin, is mutated in hyperparathyroidism-jaw tumor syndrome. | 12434154 | 2002 | |||||||
|
|
|
0.700 | GeneticVariation | UNIPROT | Clinical, genetic, and histopathologic investigation of CDC73-related familial hyperparathyroidism. | 18755853 | 2008 | |||||||
|
|
|
0.700 | GeneticVariation | UNIPROT | The parafibromin tumor suppressor protein is part of a human Paf1 complex. | 15632063 | 2005 | |||||||
|
|
|
0.700 | GeneticVariation | UNIPROT | HRPT2 mutations are associated with malignancy in sporadic parathyroid tumours. | 12960210 | 2003 | |||||||
|
|
|
0.700 | GeneticVariation | UNIPROT | Parafibromin mutations in hereditary hyperparathyroidism syndromes and parathyroid tumours. | 16487440 | 2006 | |||||||
|
|
|
T | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
T | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
A | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
G | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
G | 0.700 | GeneticVariation | CLINVAR | Nuclear localization of the parafibromin tumor suppressor protein implicated in the hyperparathyroidism-jaw tumor syndrome enhances its proapoptotic function. | 17314275 | 2007 | ||||||
|
|
|
CGTGCTTAGCGTCCTGCGACA | 0.700 | CausalMutation | CLINVAR | Cell division cycle protein 73 homolog (CDC73) mutations in the hyperparathyroidism-jaw tumor syndrome (HPT-JT) and parathyroid tumors. | 20052758 | 2010 | ||||||
|
|
|
A | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
A | 0.700 | CausalMutation | CLINVAR |